Rv1247c - conserved hypothetical protein

Expression: Most Significant Conditions for Rv1247c

Protein Domains

Gene Information
Locus	Rv1247c
Symbol
Gene Name	conserved hypothetical protein
Location	1388975 - 1389244 (-)
Species	Mycobacterium tuberculosis H37Rv complete genome.
Length	Gene:270 bp Protein:90 aa
External Links	Tuberculist Target Gene Information String Protein-Protein Interactions STITCH Chemical-Protein Interactions Search Google Scholar
Orthologs
Orthogroup Number	8954
Related Genes
Transcriptional Regulation
Operons	View gene in operon browser
Regulatory Network	Search for regulators of Rv1247c
Expression Correlation	Genes with Correlated Expression Scatterplot of Gene Expression

Sequence

Proteins

>Rv1247c Transcript 1
MAVVPLGEVRNRLSEYVAEVELTHERITITRHGHPAAVLISADDLASIEETLEVLRTPGA
SEAIREGLADVAAGRFVSNDEIRNRYTAR*

Genomic Sequence

>Rv1247c
ATGGCTGTTGTCCCACTGGGCGAAGTCCGCAATCGCCTCTCTGAGTACGTCGCCGAAGTT
GAGCTGACACACGAGCGCATCACGATAACCCGGCACGGTCATCCGGCGGCGGTATTGATC
TCGGCCGATGACCTGGCGTCCATCGAGGAAACGCTGGAGGTGCTACGCACCCCTGGCGCC
AGCGAGGCCATTCGTGAAGGCCTCGCCGATGTTGCCGCAGGGCGCTTCGTGAGCAACGAC
GAGATCCGCAACCGTTACACCGCGCGGTGA

Community Annotations Pending Curatorial Review

Field	Value	Status	Creator	Date
Interaction	Inhibits Rv1246c	active	aparna.vchalam	2012-10-05
	Affinity purification (Physical interaction) SB. Korch, H. Contreras et al. Three Mycobacterium tuberculosis Rel toxin:antitoxin modules inhibit mycobacterial growth and are expressed in human-infected macrophages. J. Bacteriol. 2008
Interaction	Inhibits Rv1246c	active	aparna.vchalam	2012-10-05
	Affinity purification (Physical interaction) ZL. Shang, L. Bao et al. [Protein-protein interaction between hypothetical protein Rv1246c and Rv1247c of Mycobacterium tuberculosis] Sichuan Da Xue Xue Bao Yi Xue Ban 2007
Interaction	Inhibits Rv1246c	active	aparna.vchalam	2012-10-05
	Affinity purification (Physical interaction) SB. Korch, H. Contreras et al. Three Mycobacterium tuberculosis Rel toxin:antitoxin modules inhibit mycobacterial growth and are expressed in human-infected macrophages. J. Bacteriol. 2008
Interaction	Inhibits Rv1246c	active	aparna.vchalam	2012-10-05
	Affinity purification (Physical interaction) ZL. Shang, L. Bao et al. [Protein-protein interaction between hypothetical protein Rv1246c and Rv1247c of Mycobacterium tuberculosis] Sichuan Da Xue Xue Bao Yi Xue Ban 2007
Symbol	relB	active	jlew	2012-03-07
	Each pair shows interaction by two-hybrid and GST pulldown. F and B each interact with E, G, K, and itself. authors,M. Yang,C. Gao,Y. Wang,H. Zhang,ZG. He Characterization of the interaction and cross-regulation of three Mycobacterium tuberculosis RelBE modules. PLoS ONE 2010
Symbol	relB1	active	jlew	2012-03-07
	Each toxin individually arrests growth of both M. tuberculosis and E. coli, an effect that is neutralized by coexpression of the cognate antitoxin. authors,R. Singh,CE. Barry,HI. Boshoff The three RelE homologs of Mycobacterium tuberculosis have individual, drug-specific effects on bacterial antibiotic tolerance. J. Bacteriol. 2010
Symbol	relB	active	jlew	2012-03-07
	relB and relE interact directly. Overexpression of Mtb relE, relG and relK induces growth arrest in Msmeg; reversed by expression of relB, relF and relJ SB. Korch, H. Contreras et al. Three Mycobacterium tuberculosis Rel toxin:antitoxin modules inhibit mycobacterial growth and are expressed in human-infected macrophages. J. Bacteriol. 2008
Symbol	RelB1	active	jlew	2012-03-07
	We report the heterologous toxicity of these TA loci in Escherichia coli and show that only a few of the M. tuberculosis-encoded toxins can inhibit E. coli growth and have a killing effect. This killing effect can be suppressed by coexpression of the cognate antitoxin. authors,A. Gupta Killing activity and rescue function of genome-wide toxin-antitoxin loci of Mycobacterium tuberculosis. FEMS Microbiol. Lett. 2009
Other	strand:+	active	rslayden	2012-03-05
	ECAE0002933 92 aa), FASTA scores: opt: 127, E(): 0.0038, (29.3% identity in 82 aa overlap). TBparse score is 0.905.
Other	stop:1389244	active	rslayden	2012-03-05
	ECAE0002933 92 aa), FASTA scores: opt: 127, E(): 0.0038, (29.3% identity in 82 aa overlap). TBparse score is 0.905.
Other	start:1388975	active	rslayden	2012-03-05
	ECAE0002933 92 aa), FASTA scores: opt: 127, E(): 0.0038, (29.3% identity in 82 aa overlap). TBparse score is 0.905.
Symbol	rel BE-1	active	rslayden	2012-03-05
	ECAE0002933 92 aa), FASTA scores: opt: 127, E(): 0.0038, (29.3% identity in 82 aa overlap). TBparse score is 0.905.
Other	strand:+	active	rslayden	2012-03-05
	P95225 (169 aa) opt: 125, E(): 0.0089,(41.8% identity in 55 aa overlap); etc. and Escherichia coli AE000293
Other	stop:1389244	active	rslayden	2012-03-05
	P95225 (169 aa) opt: 125, E(): 0.0089,(41.8% identity in 55 aa overlap); etc. and Escherichia coli AE000293
Other	start:1388975	active	rslayden	2012-03-05
	P95225 (169 aa) opt: 125, E(): 0.0089,(41.8% identity in 55 aa overlap); etc. and Escherichia coli AE000293
Symbol	rel BE-1	active	rslayden	2012-03-05
	P95225 (169 aa) opt: 125, E(): 0.0089,(41.8% identity in 55 aa overlap); etc. and Escherichia coli AE000293
Other	strand:+	active	rslayden	2012-03-05
	Z86089
Other	stop:1389244	active	rslayden	2012-03-05
	Z86089
Other	start:1388975	active	rslayden	2012-03-05
	Z86089
Symbol	rel BE-1	active	rslayden	2012-03-05
	Z86089
Other	strand:+	active	rslayden	2012-03-05
	MTV003.11 (93 aa), FASTA scores: opt: 249, E(): 5.4e-13, (44.2% identity in 86 aa overlap); Rv0268
Other	stop:1389244	active	rslayden	2012-03-05
	MTV003.11 (93 aa), FASTA scores: opt: 249, E(): 5.4e-13, (44.2% identity in 86 aa overlap); Rv0268
Other	start:1388975	active	rslayden	2012-03-05
	MTV003.11 (93 aa), FASTA scores: opt: 249, E(): 5.4e-13, (44.2% identity in 86 aa overlap); Rv0268
Symbol	rel BE-1	active	rslayden	2012-03-05
	MTV003.11 (93 aa), FASTA scores: opt: 249, E(): 5.4e-13, (44.2% identity in 86 aa overlap); Rv0268
Other	strand:+	active	rslayden	2012-03-05
	Conserved hypothetical protein, some similarity to hypothetical proteins including Mycobacterium tuberculosis proteins Rv2865
Other	stop:1389244	active	rslayden	2012-03-05
	Conserved hypothetical protein, some similarity to hypothetical proteins including Mycobacterium tuberculosis proteins Rv2865
Other	start:1388975	active	rslayden	2012-03-05
	Conserved hypothetical protein, some similarity to hypothetical proteins including Mycobacterium tuberculosis proteins Rv2865
Symbol	rel BE-1	active	rslayden	2012-03-05
	Conserved hypothetical protein, some similarity to hypothetical proteins including Mycobacterium tuberculosis proteins Rv2865