Rv1839c - conserved hypothetical protein

Expression: Most Significant Conditions for Rv1839c

Protein Domains

Gene Information
Locus	Rv1839c
Symbol
Gene Name	conserved hypothetical protein
Location	2087649 - 2087912 (-)
Species	Mycobacterium tuberculosis H37Rv complete genome.
Length	Gene:264 bp Protein:88 aa
External Links	Tuberculist Target Gene Information String Protein-Protein Interactions STITCH Chemical-Protein Interactions Search Google Scholar
Orthologs
Orthogroup Number	9030
Related Genes	MT1887
Transcriptional Regulation
Operons	View gene in operon browser
Regulatory Network	Search for regulators of Rv1839c
Expression Correlation	Genes with Correlated Expression Scatterplot of Gene Expression

Sequence

Proteins

>Rv1839c Transcript 1
MSKRLQVLLDPDEWEELREIARRHRTTVSEWVRRTLREAREREPRGDLDMKLRSVRAAAR
HEFPTADVEQMLEEIERGRGAEREGSR*

Genomic Sequence

>Rv1839c
ATGAGTAAGCGCCTGCAGGTTCTGCTGGACCCCGACGAGTGGGAAGAACTCCGAGAGATT
GCACGCCGGCACCGCACGACAGTGTCCGAGTGGGTCCGCCGGACGCTGCGGGAGGCGCGG
GAGCGAGAACCGCGCGGCGATCTAGACATGAAGCTGCGATCTGTCCGTGCCGCCGCACGC
CATGAGTTCCCGACAGCCGACGTCGAGCAGATGCTCGAGGAAATCGAACGCGGACGCGGT
GCGGAGCGCGAAGGATCACGGTGA

Community Annotations Pending Curatorial Review

Field	Value	Status	Creator	Date
Interaction	Regulatory Rv1838c	active	ilamathi.raja	2012-10-05
	Co-occurrence (Functional linkage) authors,HR. Ramage,LE. Connolly,JS. Cox Comprehensive functional analysis of Mycobacterium tuberculosis toxin-antitoxin systems: implications for pathogenesis, stress responses, and evolution. PLoS Genet. 2009
Interaction	Regulatory Rv1838c	active	ilamathi.raja	2012-10-05
	Co-occurrence (Functional linkage) authors,A. Gupta Killing activity and rescue function of genome-wide toxin-antitoxin loci of Mycobacterium tuberculosis. FEMS Microbiol. Lett. 2009
Interaction	Regulatory Rv1838c	active	ilamathi.raja	2012-10-05
	Co-occurrence (Functional linkage) authors,HR. Ramage,LE. Connolly,JS. Cox Comprehensive functional analysis of Mycobacterium tuberculosis toxin-antitoxin systems: implications for pathogenesis, stress responses, and evolution. PLoS Genet. 2009
Interaction	Regulatory Rv1838c	active	ilamathi.raja	2012-10-05
	Co-occurrence (Functional linkage) authors,A. Gupta Killing activity and rescue function of genome-wide toxin-antitoxin loci of Mycobacterium tuberculosis. FEMS Microbiol. Lett. 2009
Symbol	VapB13	active	jlew	2012-03-07
	We report the heterologous toxicity of these TA loci in Escherichia coli and show that only a few of the M. tuberculosis-encoded toxins can inhibit E. coli growth and have a killing effect. This killing effect can be suppressed by coexpression of the cognate antitoxin. authors,A. Gupta Killing activity and rescue function of genome-wide toxin-antitoxin loci of Mycobacterium tuberculosis. FEMS Microbiol. Lett. 2009
Other	strand:+	active	rslayden	2012-03-05
	Conserved hypothetical protein. Some similarity to G217008 CHO-ORF1 (279 aa), FASTA scores: opt: 86, E(): 13, (38.7% identity in 62 aa overlap). TBparse score is 1.006.
Other	stop:2087912	active	rslayden	2012-03-05
	Conserved hypothetical protein. Some similarity to G217008 CHO-ORF1 (279 aa), FASTA scores: opt: 86, E(): 13, (38.7% identity in 62 aa overlap). TBparse score is 1.006.
Other	start:2087649	active	rslayden	2012-03-05
	Conserved hypothetical protein. Some similarity to G217008 CHO-ORF1 (279 aa), FASTA scores: opt: 86, E(): 13, (38.7% identity in 62 aa overlap). TBparse score is 1.006.
Symbol	Vap BC-13	active	rslayden	2012-03-05
	Conserved hypothetical protein. Some similarity to G217008 CHO-ORF1 (279 aa), FASTA scores: opt: 86, E(): 13, (38.7% identity in 62 aa overlap). TBparse score is 1.006.