Rv2526 - hypothetical protein

Expression: Most Significant Conditions for Rv2526

Protein Domains

Gene Information
Locus	Rv2526
Symbol
Gene Name	hypothetical protein
Location	2851091 - 2851318 (+)
Species	Mycobacterium tuberculosis H37Rv complete genome.
Length	Gene:228 bp Protein:76 aa
External Links	Tuberculist Target Gene Information String Protein-Protein Interactions STITCH Chemical-Protein Interactions Search Google Scholar
Orthologs
Orthogroup Number	9140
Related Genes
Transcriptional Regulation
Operons	View gene in operon browser
Regulatory Network	Search for regulators of Rv2526
Expression Correlation	Genes with Correlated Expression Scatterplot of Gene Expression

Sequence

Proteins

>Rv2526 Transcript 1
MTVKRTTIELDEDLVRAAQAVTGETLRATVERALQQLVAAAAEQAAARRRRIVDHLAHAG
THVDADVLLSEQAWR*

Genomic Sequence

>Rv2526
ATGACCGTAAAGAGGACCACGATTGAGCTGGACGAAGATCTTGTGCGGGCAGCCCAGGCC
GTCACCGGGGAAACATTGCGAGCGACGGTCGAGCGCGCGCTGCAGCAGCTGGTGGCCGCG
GCTGCCGAGCAGGCCGCCGCGCGCCGGCGGCGGATCGTCGACCATCTCGCGCACGCCGGC
ACTCACGTGGACGCAGACGTGCTGCTCTCCGAGCAGGCGTGGCGATGA

Community Annotations Pending Curatorial Review

Field	Value	Status	Creator	Date
Interaction	Inhibition Rv2527	active	soumisengupta	2012-10-05
	Co-expression (Functional linkage) authors,A. Gupta Killing activity and rescue function of genome-wide toxin-antitoxin loci of Mycobacterium tuberculosis. FEMS Microbiol. Lett. 2009
Interaction	Inhibition Rv2527	active	soumisengupta	2012-10-05
	Co-expression (Functional linkage) authors,VL. Arcus,PB. Rainey,SJ. Turner The PIN-domain toxin-antitoxin array in mycobacteria. Trends Microbiol. 2005
Interaction	Inhibits Rv2527	active	kandarpbioinfo	2012-10-05
	Gene neighbourhood authors,HR. Ramage,LE. Connolly,JS. Cox Comprehensive functional analysis of Mycobacterium tuberculosis toxin-antitoxin systems: implications for pathogenesis, stress responses, and evolution. PLoS Genet. 2009
Interaction	Inhibits Rv2527	active	kandarpbioinfo	2012-10-05
	Gene neighbourhood authors,DP. Pandey,K. Gerdes Toxin-antitoxin loci are highly abundant in free-living but lost from host-associated prokaryotes. Nucleic Acids Res. 2005
Interaction	Inhibits Rv2527	active	kandarpbioinfo	2012-10-05
	Gene neighbourhood authors,VL. Arcus,PB. Rainey,SJ. Turner The PIN-domain toxin-antitoxin array in mycobacteria. Trends Microbiol. 2005
Symbol	VapB17	active	jlew	2012-03-07
	We report the heterologous toxicity of these TA loci in Escherichia coli and show that only a few of the M. tuberculosis-encoded toxins can inhibit E. coli growth and have a killing effect. This killing effect can be suppressed by coexpression of the cognate antitoxin. authors,A. Gupta Killing activity and rescue function of genome-wide toxin-antitoxin loci of Mycobacterium tuberculosis. FEMS Microbiol. Lett. 2009
Other	strand:+	active	rslayden	2012-03-05
	Hypothetical unknown protein. TBparse score is 0.877
Other	stop:2851318	active	rslayden	2012-03-05
	Hypothetical unknown protein. TBparse score is 0.877
Other	start:2851091	active	rslayden	2012-03-05
	Hypothetical unknown protein. TBparse score is 0.877
Symbol	Vap BC-17	active	rslayden	2012-03-05
	Hypothetical unknown protein. TBparse score is 0.877