Rv1853 - urease accessory protein ureD

Expression: Most Significant Conditions for Rv1853

Protein Domains

Gene Information
Locus	Rv1853
Symbol	ureD
Gene Name	urease accessory protein ureD
Location	2101022 - 2101648 (+)
Species	Mycobacterium tuberculosis H37Rv complete genome.
Length	Gene:627 bp Protein:209 aa
External Links	Tuberculist Target Gene Information String Protein-Protein Interactions STITCH Chemical-Protein Interactions Search Google Scholar
Orthologs
Orthogroup Number	24728
Related Genes	Mkms_2846 Mmcs_2802 MSMEG_3622 MT1901 MUL_3026 Mvan_3079 nfa25410 SAV7109
Transcriptional Regulation
Operons	View gene in operon browser
Regulatory Network	Search for regulators of Rv1853
Expression Correlation	Genes with Correlated Expression Scatterplot of Gene Expression

Sequence

Proteins

>Rv1853 Transcript 1
MVASPNRLPRIDCRGGVQARRTAPDTVHLVSAAATPLGGDTMRIRVIVERGAQLRLRSAA
ATVALPGVDTLTSHAHWEIDVTGTLDVDLEPTVVAASARHLSHATLRLHDDGRVRLRERV
QIGRCNEREGFWSSSLQADRHGRPLLRHRVELGAGSLADDVIAAPRATISELRYPATAFT
DAIDARSTVLALAGGGTLSTWQADRLPG*

Genomic Sequence

>Rv1853
GTGGTCGCGTCGCCGAATCGGTTGCCGCGCATCGACTGTCGGGGCGGTGTCCAGGCACGC
CGAACCGCGCCCGACACGGTGCACCTGGTGTCGGCGGCCGCGACCCCGCTGGGCGGTGAC
ACCATGAGAATCCGGGTGATCGTGGAACGGGGTGCCCAGCTACGGCTGCGTAGTGCCGCC
GCGACGGTGGCCTTGCCCGGCGTGGATACCCTGACGTCGCATGCTCACTGGGAGATCGAC
GTGACCGGCACCCTGGATGTGGACCTGGAGCCGACGGTCGTCGCCGCCTCAGCCCGGCAT
CTGTCGCATGCCACCTTGCGCCTGCACGACGACGGTCGGGTCCGCTTGCGCGAGCGCGTG
CAGATTGGCAGATGCAATGAGCGCGAAGGATTTTGGTCGTCATCGCTGCAGGCCGATCGG
CATGGTCGTCCCCTGCTGCGGCACCGGGTGGAACTGGGTGCCGGGTCTTTGGCCGACGAC
GTCATTGCGGCGCCGCGCGCCACTATCAGCGAGCTGCGCTATCCGGCGACGGCATTCACC
GACGCCATCGACGCACGGTCGACCGTTTTGGCGTTGGCGGGTGGCGGAACACTGAGTACC
TGGCAGGCTGACCGGTTGCCTGGCTAA

Community Annotations Pending Curatorial Review

Field	Value	Status	Creator	Date
Interaction	PhysicalInteraction Rv1851	active	sourish10	2012-10-05
	Structural Analysis authors,JE. Habel,EH. Bursey,BS. Rho,CY. Kim,BW. Segelke,B. Rupp,MS. Park,TC. Terwilliger,LW. Hung Structure of Rv1848 (UreA), the Mycobacterium tuberculosis urease gamma subunit. Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 2010
Interaction	PhysicalInteraction Rv1852	active	sourish10	2012-10-05
	Structural Analysis authors,JE. Habel,EH. Bursey,BS. Rho,CY. Kim,BW. Segelke,B. Rupp,MS. Park,TC. Terwilliger,LW. Hung Structure of Rv1848 (UreA), the Mycobacterium tuberculosis urease gamma subunit. Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 2010
Interaction	PhysicalInteraction Rv1851	active	sourish10	2012-10-05
	Spectrophotometric Assay authors,JE. Habel,EH. Bursey,BS. Rho,CY. Kim,BW. Segelke,B. Rupp,MS. Park,TC. Terwilliger,LW. Hung Structure of Rv1848 (UreA), the Mycobacterium tuberculosis urease gamma subunit. Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 2010
Interaction	PhysicalInteraction Rv1852	active	sourish10	2012-10-05
	Spectrophotometric Assay authors,JE. Habel,EH. Bursey,BS. Rho,CY. Kim,BW. Segelke,B. Rupp,MS. Park,TC. Terwilliger,LW. Hung Structure of Rv1848 (UreA), the Mycobacterium tuberculosis urease gamma subunit. Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 2010
Interaction	PhysicalInteraction Rv1852	active	sourish10	2012-10-05
	Structural Analysis authors,JE. Habel,EH. Bursey,BS. Rho,CY. Kim,BW. Segelke,B. Rupp,MS. Park,TC. Terwilliger,LW. Hung Structure of Rv1848 (UreA), the Mycobacterium tuberculosis urease gamma subunit. Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 2010
Interaction	PhysicalInteraction Rv1852	active	sourish10	2012-10-05
	Spectrophotometric Assay authors,JE. Habel,EH. Bursey,BS. Rho,CY. Kim,BW. Segelke,B. Rupp,MS. Park,TC. Terwilliger,LW. Hung Structure of Rv1848 (UreA), the Mycobacterium tuberculosis urease gamma subunit. Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 2010
Interaction	PhysicalInteraction Rv1851	active	sourish10	2012-10-05
	Structural Analysis authors,JE. Habel,EH. Bursey,BS. Rho,CY. Kim,BW. Segelke,B. Rupp,MS. Park,TC. Terwilliger,LW. Hung Structure of Rv1848 (UreA), the Mycobacterium tuberculosis urease gamma subunit. Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 2010
Interaction	PhysicalInteraction Rv1851	active	sourish10	2012-10-05
	Spectrophotometric Assay authors,JE. Habel,EH. Bursey,BS. Rho,CY. Kim,BW. Segelke,B. Rupp,MS. Park,TC. Terwilliger,LW. Hung Structure of Rv1848 (UreA), the Mycobacterium tuberculosis urease gamma subunit. Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 2010
Interaction	RegulatedBy Rv3286c	active	yamir.moreno	2012-10-05
	Microarrays. mRNA levels of regulated element measured and compared between wild-type and trans-element mutation (knockout, over expression etc.) performed by using microarray (or macroarray) experiments.. qRT-PCR. mRNA expression levels of regulated element measured and compared between wild-type and trans-element mutation (knockout, over expression etc.) performed by using qRT-PCR technique. EP. Williams, JH. Lee et al. Mycobacterium tuberculosis SigF regulates genes encoding cell wall-associated proteins and directly regulates the transcriptional regulatory gene phoY1. J. Bacteriol. 2007
Interaction	RegulatedBy Rv3286c	active	yamir.moreno	2012-10-05
	Microarrays. mRNA levels of regulated element measured and compared between wild-type and trans-element mutation (knockout, over expression etc.) performed by using microarray (or macroarray) experiments.. qRT-PCR. mRNA expression levels of regulated element measured and compared between wild-type and trans-element mutation (knockout, over expression etc.) performed by using qRT-PCR technique. EP. Williams, JH. Lee et al. Mycobacterium tuberculosis SigF regulates genes encoding cell wall-associated proteins and directly regulates the transcriptional regulatory gene phoY1. J. Bacteriol. 2007
Term	EC:3.5.1.5 Urease. - NR	active	jjmcfadden	2012-03-05
	Inferred from direct assay authors,DL. Clemens,BY. Lee,MA. Horwitz Purification, characterization, and genetic analysis of Mycobacterium tuberculosis urease, a potentially critical determinant of host-pathogen interaction. J. Bacteriol. 1995