Rv1942c - conserved hypothetical protein

Expression: Most Significant Conditions for Rv1942c

Protein Domains

Gene Information
Locus	Rv1942c
Symbol
Gene Name	conserved hypothetical protein
Location	2194644 - 2194973 (-)
Species	Mycobacterium tuberculosis H37Rv complete genome.
Length	Gene:330 bp Protein:110 aa
External Links	Tuberculist Target Gene Information String Protein-Protein Interactions STITCH Chemical-Protein Interactions Search Google Scholar
Orthologs
Orthogroup Number	12869
Related Genes	MT1992
Transcriptional Regulation
Operons	View gene in operon browser
Regulatory Network	Search for regulators of Rv1942c
Expression Correlation	Genes with Correlated Expression Scatterplot of Gene Expression

Sequence

Proteins

>Rv1942c Transcript 1
MTALPARGEVWWCEMAEIGRRPVVVLSRDAAIPRLRRALVAPCTTTIRGLASEVVLEPGS
DPIPRRSAVNLDSVESVSVAVLVNRLGRLADIRMRAICTALEVAVDCSR*

Genomic Sequence

>Rv1942c
GTGACCGCACTTCCGGCGCGCGGAGAGGTGTGGTGGTGTGAGATGGCTGAGATCGGTCGG
CGACCAGTCGTCGTGCTGTCGCGCGATGCCGCGATCCCTCGGCTGCGACGCGCACTTGTC
GCGCCCTGCACCACGACCATCCGAGGGCTAGCCAGTGAGGTTGTTCTTGAACCCGGTTCC
GACCCGATCCCGCGCCGTTCCGCGGTGAATTTGGACTCAGTCGAAAGTGTCTCGGTCGCG
GTATTGGTGAATCGGCTTGGCCGCCTCGCCGACATCCGGATGCGCGCCATCTGCACGGCC
CTCGAGGTCGCCGTCGATTGCTCTCGATGA

Community Annotations Pending Curatorial Review

Field	Value	Status	Creator	Date
Interaction	Regulatory Rv1943c	active	shahanup86	2012-10-05
	Affinity purification (Physical interaction) authors,VL. Arcus,PB. Rainey,SJ. Turner The PIN-domain toxin-antitoxin array in mycobacteria. Trends Microbiol. 2005
Interaction	Regulatory Rv1943c	active	shahanup86	2012-10-05
	Affinity purification (Physical interaction) authors,HR. Ramage,LE. Connolly,JS. Cox Comprehensive functional analysis of Mycobacterium tuberculosis toxin-antitoxin systems: implications for pathogenesis, stress responses, and evolution. PLoS Genet. 2009
Interaction	Regulatory Rv1943c	active	shahanup86	2012-10-05
	Affinity purification (Physical interaction) authors,VL. Arcus,PB. Rainey,SJ. Turner The PIN-domain toxin-antitoxin array in mycobacteria. Trends Microbiol. 2005
Interaction	Regulatory Rv1943c	active	shahanup86	2012-10-05
	Affinity purification (Physical interaction) authors,HR. Ramage,LE. Connolly,JS. Cox Comprehensive functional analysis of Mycobacterium tuberculosis toxin-antitoxin systems: implications for pathogenesis, stress responses, and evolution. PLoS Genet. 2009
Interaction	Regulatory Rv0616c	active	akankshajain.21	2012-10-05
	Co-expression (Functional linkage) T. Parish, DA. Smith et al. The senX3-regX3 two-component regulatory system of Mycobacterium tuberculosis is required for virulence. Microbiology (Reading, Engl.) 2003
Interaction	RegulatedBy Rv1963c	active	yamir.moreno	2012-10-05
	Microarrays. mRNA levels of regulated element measured and compared between wild-type and trans-element mutation (knockout, over expression etc.) performed by using microarray (or macroarray) experiments.. qRT-PCR. mRNA expression levels of regulated element measured and compared between wild-type and trans-element mutation (knockout, over expression etc.) performed by using qRT-PCR technique. MP. Santangelo, FC. Blanco et al. Study of the role of Mce3R on the transcription of mce genes of Mycobacterium tuberculosis. BMC Microbiol. 2008
Interaction	RegulatedBy Rv1963c	active	yamir.moreno	2012-10-05
	Microarrays. mRNA levels of regulated element measured and compared between wild-type and trans-element mutation (knockout, over expression etc.) performed by using microarray (or macroarray) experiments.. qRT-PCR. mRNA expression levels of regulated element measured and compared between wild-type and trans-element mutation (knockout, over expression etc.) performed by using qRT-PCR technique. MP. Santangelo, FC. Blanco et al. Study of the role of Mce3R on the transcription of mce genes of Mycobacterium tuberculosis. BMC Microbiol. 2008
Interaction	RegulatedBy Rv0491	active	yamir.moreno	2012-10-05
	Microarrays. mRNA levels of regulated element measured and compared between wild-type and trans-element mutation (knockout, over expression etc.) performed by using microarray (or macroarray) experiments.. T. Parish, DA. Smith et al. The senX3-regX3 two-component regulatory system of Mycobacterium tuberculosis is required for virulence. Microbiology (Reading, Engl.) 2003
Symbol	MazF5	active	jlew	2012-03-07
	We report the heterologous toxicity of these TA loci in Escherichia coli and show that only a few of the M. tuberculosis-encoded toxins can inhibit E. coli growth and have a killing effect. This killing effect can be suppressed by coexpression of the cognate antitoxin. authors,A. Gupta Killing activity and rescue function of genome-wide toxin-antitoxin loci of Mycobacterium tuberculosis. FEMS Microbiol. Lett. 2009
Symbol	mazF-mt5	active	jlew	2012-03-07
	authors,L. Zhu,Y. Zhang,JS. Teh,J. Zhang,N. Connell,H. Rubin,M. Inouye Characterization of mRNA interferases from Mycobacterium tuberculosis. J. Biol. Chem. 2006
Other	strand:+	active	rslayden	2012-03-05
	hypothetical protein
Other	stop:2194973	active	rslayden	2012-03-05
	hypothetical protein
Other	start:2194644	active	rslayden	2012-03-05
	hypothetical protein