Rv3112 - molybdenum cofactor biosynthesis protein D moaD1

Expression: Most Significant Conditions for Rv3112

Protein Domains

Gene Information
Locus	Rv3112
Symbol	moaD1
Gene Name	molybdenum cofactor biosynthesis protein D moaD1
Location	3479700 - 3479951 (+)
Species	Mycobacterium tuberculosis H37Rv complete genome.
Length	Gene:252 bp Protein:84 aa
External Links	Tuberculist Target Gene Information String Protein-Protein Interactions STITCH Chemical-Protein Interactions Search Google Scholar
Orthologs
Orthogroup Number	9223
Related Genes
Transcriptional Regulation
Operons	View gene in operon browser
Regulatory Network	Search for regulators of Rv3112
Expression Correlation	Genes with Correlated Expression Scatterplot of Gene Expression

Sequence

Proteins

>Rv3112 Transcript 1
MIKVNVLYFGAVREACDETPREEVEVQNGTDVGNLVDQLQQKYPRLRDHCQRVQMAVNQF
IAPLSTVLGDGDEVAFIPQVAGG*

Genomic Sequence

>Rv3112
ATGATTAAAGTGAATGTTCTTTACTTCGGTGCCGTTCGTGAGGCGTGTGACGAAACGCCT
CGGGAGGAAGTAGAGGTTCAGAACGGTACCGATGTCGGGAATCTTGTTGATCAACTCCAG
CAAAAATACCCTCGCCTTCGCGATCATTGTCAGCGAGTACAGATGGCGGTCAACCAATTC
ATCGCGCCGCTGTCGACCGTTCTCGGCGATGGTGATGAGGTCGCCTTCATCCCGCAGGTA
GCCGGAGGCTGA

Community Annotations Pending Curatorial Review

Field	Value	Status	Creator	Date
Interaction	PhysicalInteraction Rv3324c	active	priti.priety	2012-10-05
	Co-occurrence(Functional-linkage) authors,PR. Marri,JP. Bannantine,GB. Golding Comparative genomics of metabolic pathways in Mycobacterium species: gene duplication, gene decay and lateral gene transfer. FEMS Microbiol. Rev. 2006
Interaction	PhysicalInteraction Rv3324A	active	priti.priety	2012-10-05
	Co-occurrence(Functional-linkage) authors,MS. Cortese,AB. Caplan,RL. Crawford Structural, functional, and evolutionary analysis of moeZ, a gene encoding an enzyme required for the synthesis of the Pseudomonas metabolite, pyridine-2,6-bis(thiocarboxylic acid). BMC Evol. Biol. 2002
Interaction	PhysicalInteraction Rv3324A	active	priti.priety	2012-10-05
	Co-occurrence(Functional-linkage) authors,PR. Marri,JP. Bannantine,GB. Golding Comparative genomics of metabolic pathways in Mycobacterium species: gene duplication, gene decay and lateral gene transfer. FEMS Microbiol. Rev. 2006
Interaction	Operon Rv3112	active	priyadarshinipriyanka2001	2012-10-05
	Geneneighbourhood authors,W. Zhang,A. Urban,H. Mihara,S. Leimkühler,T. Kurihara,N. Esaki IscS functions as a primary sulfur-donating enzyme by interacting specifically with MoeB and MoaD in the biosynthesis of molybdopterin in Escherichia coli. J. Biol. Chem. 2010
Interaction	Operon Rv3112	active	priyadarshinipriyanka2001	2012-10-05
	Geneneighbourhood authors,W. Zhang,A. Urban,H. Mihara,S. Leimkühler,T. Kurihara,N. Esaki IscS functions as a primary sulfur-donating enzyme by interacting specifically with MoeB and MoaD in the biosynthesis of molybdopterin in Escherichia coli. J. Biol. Chem. 2010
Interaction	Operon Rv3112	active	priyadarshinipriyanka2001	2012-10-05
	Geneneighbourhood authors,S. Mostowy,J. Inwald,S. Gordon,C. Martin,R. Warren,K. Kremer,D. Cousins,MA. Behr Revisiting the evolution of Mycobacterium bovis. J. Bacteriol. 2005
Interaction	Operon Rv3112	active	priyadarshinipriyanka2001	2012-10-05
	Geneneighbourhood authors,S. Mostowy,J. Inwald,S. Gordon,C. Martin,R. Warren,K. Kremer,D. Cousins,MA. Behr Revisiting the evolution of Mycobacterium bovis. J. Bacteriol. 2005
Interaction	Operon Rv3112	active	priyadarshinipriyanka2001	2012-10-05
	Geneneighbourhood authors,MW. Lake,MM. Wuebbens,KV. Rajagopalan,H. Schindelin Mechanism of ubiquitin activation revealed by the structure of a bacterial MoeB-MoaD complex. Nature 2001
Interaction	Operon Rv3112	active	priyadarshinipriyanka2001	2012-10-05
	Geneneighbourhood authors,MW. Lake,MM. Wuebbens,KV. Rajagopalan,H. Schindelin Mechanism of ubiquitin activation revealed by the structure of a bacterial MoeB-MoaD complex. Nature 2001