Rv3857c - membrane protein

Expression: Most Significant Conditions for Rv3857c

Protein Domains

Gene Information
Locus	Rv3857c
Symbol
Gene Name	membrane protein
Location	4329417 - 4329614 (-)
Species	Mycobacterium tuberculosis H37Rv complete genome.
Length	Gene:198 bp Protein:66 aa
External Links	Tuberculist Target Gene Information String Protein-Protein Interactions STITCH Chemical-Protein Interactions Search Google Scholar
Orthologs
Orthogroup Number	7861
Related Genes	MAP0176 MAV_0170 MSMEG_6442 MT3972 Mvan_0295
Transcriptional Regulation
Operons	View gene in operon browser
Regulatory Network	Search for regulators of Rv3857c
Expression Correlation	Genes with Correlated Expression Scatterplot of Gene Expression

Sequence

Proteins

>Rv3857c Transcript 1
MNCALGFDTKPILLASYVTHGARRATANQFERPAKGAGVLMALLILGEMAGFAVVVTGVV
FGQLV*

Genomic Sequence

>Rv3857c
ATGAACTGTGCCCTCGGATTTGATACGAAACCCATCCTGTTGGCGAGTTATGTCACCCAT
GGCGCGCGCCGTGCCACCGCGAACCAATTCGAGCGTCCCGCAAAGGGTGCGGGGGTGTTA
ATGGCGTTGCTCATCCTCGGCGAAATGGCCGGCTTCGCGGTGGTTGTCACCGGGGTCGTC
TTCGGGCAACTGGTGTGA

Community Annotations Pending Curatorial Review

Field	Value	Status	Creator	Date
Interaction	Transcription Rv3676	active	ashwinigbhat	2012-10-05
	ChIP (Physical interaction) G. Bai, MA. Gazdik et al. The Mycobacterium bovis BCG cyclic AMP receptor-like protein is a functional DNA binding protein in vitro and in vivo, but its activity differs from that of its M. tuberculosis ortholog, Rv3676. Infect. Immun. 2007
Interaction	Transcription Rv3676	active	priti.priety	2012-10-05
	ChIP (Physical interaction) G. Bai, MA. Gazdik et al. The Mycobacterium bovis BCG cyclic AMP receptor-like protein is a functional DNA binding protein in vitro and in vivo, but its activity differs from that of its M. tuberculosis ortholog, Rv3676. Infect. Immun. 2007
Interaction	Transcription Rv3676	active	jgalag	2012-10-05
	Band shift M. Stapleton, I. Haq et al. Mycobacterium tuberculosis cAMP receptor protein (Rv3676) differs from the Escherichia coli paradigm in its cAMP binding and DNA binding properties and transcription activation properties. J. Biol. Chem. 2010
Interaction	Transcription Rv3676	active	jgalag	2012-10-05
	Band shift G. Bai, LA. McCue et al. Characterization of Mycobacterium tuberculosis Rv3676 (CRPMt), a cyclic AMP receptor protein-like DNA binding protein. J. Bacteriol. 2005
Interaction	RegulatedBy Rv3676	active	yamir.moreno	2012-10-05
	Literature previously reported link (from Balazsi et al. 2008). Traceable author statement to experimental support. G. Balázsi, AP. Heath et al. The temporal response of the Mycobacterium tuberculosis gene regulatory network during growth arrest. Mol. Syst. Biol. 2008